Top » Catalog » R1a » A11914

$18.00

A11914
[A11914]

A11914
hg38 Position: ChrY:16799297..16799297
Ancestral: T
Derived: C
Reference: Viacheslav Kudryashov (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A11914_F CAGGGAAGCTCTCCCTTATAAAAC
Reverse Primer: A11914_R GGCAGTTGCCTCCATACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies