Top » Catalog » R1a » A11916

$18.00

A11916
[A11916]

A11916
hg38 Position: ChrY:16939982..16939982
Ancestral: G
Derived: C
Reference: Viacheslav Kudryashov (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A11916_F GAATGTGATTCATTGATCAAGTTG
Reverse Primer: A11916_R CCCGACCCTCATCTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies