Top » Catalog » R1a » A11918

$18.00

A11918
[A11918]

A11918
hg38 Position: ChrY:19057473..19057473
Ancestral: C
Derived: T
Reference: Viacheslav Kudryashov (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A11918_F GCCCAGATTGTCACTCCAG
Reverse Primer: A11918_R CTCAGTCCTGGCAGATTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies