Top » Catalog » R1a » A11919

$18.00

A11919
[A11919]

A11919
hg38 Position: ChrY:19551701..19551701
Ancestral: G
Derived: A
Reference: Viacheslav Kudryashov (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A11919_F GAGACCACTGTTGTTGCCAAG
Reverse Primer: A11919_R TTTCATCTGATAAGATCTCCAGAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies