Top » Catalog » R1a » A11924

$18.00

A11924
[A11924]

A11924
hg38 Position: ChrY:16557530..16557530
Ancestral: T
Derived: G
Reference: Viacheslav Kudryashov (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A11924_F TGGTTTTTGTTTACAAAGCAGTTG
Reverse Primer: A11924_R CACACCCACATGTTGAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies