Top » Catalog » R1a » A12151

$18.00

A12151
[A12151]

A12151
HG19 Position: ChrY:14259224..14259224
Ancestral: C
Derived: A
Reference: Igor Schein (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12151_F CAGGTGTTCACCACCATGC
Reverse Primer: A12151_R AACTATTCAGCCCCAAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies