Top » Catalog » R1a » A12152

$18.00

A12152
[A12152]

A12152
HG19 Position: ChrY:14790984..14790984
Ancestral: C
Derived: A
Reference: Igor Schein (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12152_F GCTTCAACGTCAATGGTGTG
Reverse Primer: A12152_R GGTCAAAGGCCACAGGTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies