Top » Catalog » R1a » A12153

$18.00

A12153
[A12153]

A12153
HG19 Position: ChrY:15702235..15702235
Ancestral: T
Derived: C
Reference: Igor Schein (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12153_F CAAGGAAAAAGAGGCAGCAG
Reverse Primer: A12153_R CAAGACAAATGATGGGACTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies