Top » Catalog » R1a » A12154

$18.00

A12154
[A12154]

A12154
hg38 Position: ChrY:15972848..15972848
Ancestral: C
Derived: A
Reference: Igor Schein (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12154_F TCCCTAAACCCATCCCTATTG
Reverse Primer: A12154_R AAAGGGCTTGTCTTGGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies