Top » Catalog » R1a » A12156

$18.00

A12156
[A12156]

A12156
HG19 Position: ChrY:26560662..26560662
Ancestral: A
Derived: C
Reference: Igor Schein (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12156_F TTCTGATTGTATTGTGTTGTGGG
Reverse Primer: A12156_R AAAGTATTCACTAAAATTCAGGCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies