Top » Catalog » R1a » A12124

$18.00

A12124
[A12124]

A12124
HG19 Position: ChrY:12211357..12211357
Ancestral: G
Derived: A
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below YP4253
Forward Primer: A12124_F GGAGGGGTTAAACTAGTGTGAAGC
Reverse Primer: A12124_R TCTGTCTCTCTCCCCCACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies