Top » Catalog » R1a » A12125

$18.00

A12125
[A12125]

A12125
HG19 Position: ChrY:12439602..12439602
Ancestral: G
Derived: A
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below YP4253
Forward Primer: A12125_F AGACAGATAACGTGCCAGCG
Reverse Primer: A12125_R CACTGCAATCTCTACCTCCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies