Top » Catalog » R1a » A12125

$18.00

A12125
[A12125]

A12125
hg38 Position: ChrY:12439602..12439602
Ancestral: G
Derived: A
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below YP4253
Forward Primer: A12125_F AGACAGATAACGTGCCAGCG
Reverse Primer: A12125_R CACTGCAATCTCTACCTCCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies