Top » Catalog » R1a » A12128

$18.00

A12128
[A12128]

A12128
hg38 Position: ChrY:21399192..21399192
Ancestral: G
Derived: C
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below YP4253
Forward Primer: A12128_F TGGTGGCGTGGCCTG
Reverse Primer: A12128_R GTTATCCCAATCTGTTTTTAGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies