Top » Catalog » R1a » A12227

$18.00

A12227
[A12227]

A12227
HG19 Position: ChrY:11897866..11897866
Ancestral: C
Derived: G
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a
Comments: Downstream of YP1166 _ YP1167 _ YP4693 _ YP4945
Forward Primer: A12227_F TCCTTGCCTTTCCTTCTCAG
Reverse Primer: A12227_R CAGAGGTATGTGACCCAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies