Top » Catalog » R1a » A12228

$18.00

A12228
[A12228]

A12228
HG19 Position: ChrY:12362151..12362151
Ancestral: C
Derived: G
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a
Comments: Downstream of YP1166 _ YP1167 _ YP4693 _ YP4945
Forward Primer: A12228_F GAGTCAATAAAGTTAATACAAGTTAGGGTATCAG
Reverse Primer: A12228_R CACCGCAGTTCTGCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies