Top » Catalog » R1a » A12232

$18.00

A12232
[A12232]

A12232
hg38 Position: ChrY:15442746..15442746
Ancestral: C
Derived: T
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a
Comments: YP1166 >YP1167 > YP4693 > YP4945
Forward Primer: A12232_F CAAATCATCTTCTTTTTAAAAAGGAAAG
Reverse Primer: A12232_R TTTGTTGGCATCGTGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies