Top » Catalog » R1a » A12236

$18.00

A12236
[A12236]

A12236
HG19 Position: ChrY:15976166..15976166
Ancestral: G
Derived: A
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Below YP1166 >YP1167 > YP4693 > YP4945 > YP4944.
Forward Primer: A12236_F AGAGGGTAGAAGGATCAGTGTTG
Reverse Primer: A12236_R CATACAACTAAACTTAGCATTGCTCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies