Top » Catalog » R1a » A12430

$18.00

A12430
[A12430]

A12430
hg38 Position: ChrY:2843758..2843758
Ancestral: A
Derived: C
Reference: Vitaliy Slyadnev (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12430_F ATGACACTTAAGCCGGCAAG
Reverse Primer: A12430_R AACTTGTTGTGGGGAAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HU204
1 x B216
1 x BY8671
1 x Y16823
1 x FGC13809
1 x A23687
1 x A22573
1 x Y8850
1 x A20954
$162.00
Haplogroup Info
Other products
Currencies