Top » Catalog » R1a » A12431

$18.00

A12431
[A12431]

A12431
HG19 Position: ChrY:20492374..20492374
Ancestral: G
Derived: A
Reference: Vitaliy Slyadnev (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12431_F CTTCTGGAATGTCCCTCTGG
Reverse Primer: A12431_R GTAACACGGTGGTTTTGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies