Top » Catalog » R1a » A12432

$18.00

A12432
[A12432]

A12432
hg38 Position: ChrY:21808753..21808753
Ancestral: G
Derived: A
Reference: Vitaliy Slyadnev (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12432_F GGTGTGCCCAGAGTTTGTTC
Reverse Primer: A12432_R AACCAACAGAATGTGGGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies