Top » Catalog » R1a » A12433

$18.00

A12433
[A12433]

A12433
hg38 Position: ChrY:13271424..13271424
Ancestral: A
Derived: T
Reference: Vitaliy Slyadnev (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A12433_F TGTGGATAGCAAAGACAACAGG
Reverse Primer: A12433_R AACTCAGGCCCAGGATTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies