Top » Catalog » R1a » A12238

$18.00

A12238
[A12238]

A12238
hg38 Position: ChrY:9552411..9552411
Ancestral: C
Derived: A
Reference: Michael Cooley (2016)
ISOGG Haplogroup: R1a
Comments: YP1166 >YP1167 > YP4693 > YP4945
Forward Primer: A12238_F GCAAAGAGCTGAGGCTCTCC
Reverse Primer: A12238_R GAAAAAGTGCTTCCCGTACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies