Top » Catalog » R1a » A13333

$18.00

A13333
[A13333]

A13333
hg38 Position: ChrY:14857460..14857460
Ancestral: C
Derived: T
Reference: Timothy Cummings (2016)
ISOGG Haplogroup: R1a
Comments: Below YP355>YP609>YP618>YP984>YP983
Forward Primer: A13333_F CTGGGAGGAAGGGAGATG
Reverse Primer: A13333_R CTAGGCCTCTCCTCCAACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies