Top » Catalog » R1a » A13334

$18.00

A13334
[A13334]

A13334
hg38 Position: ChrY:19526654..19526654
Ancestral: C
Derived: T
Reference: Timothy Cummings (2016)
ISOGG Haplogroup: R1a
Comments: Below YP355>YP609>YP618>YP984>YP983
Forward Primer: A13334_F GCAAGAGATTCCCAGGTGTC
Reverse Primer: A13334_R GAAGCCTCCCTGGTACACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies