Top » Catalog » R1a » A13335

$18.00

A13335
[A13335]

A13335
hg38 Position: ChrY:20908162..20908162
Ancestral: T
Derived: G
Reference: Timothy Cummings (2016)
ISOGG Haplogroup: R1a
Comments: Below YP355>YP609>YP618>YP984>YP983
Forward Primer: A13335_F GTGGTGCCACAAACCTACAG
Reverse Primer: A13335_R AGACACCCCTGAGTGACAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies