Top » Catalog » R1a » A14346

$18.00

A14346
[A14346]

A14346
hg38 Position: ChrY:11952057..11952057
Ancestral: C
Derived: T
Reference: Yfull (2017)
ISOGG Haplogroup: R1a (not listed)
Comments: Below L260 > Y2905 > YP1364 > YP3927 > YP4772
Forward Primer: A14346_F AGGAAGGTGTGAAGGATAGGC
Reverse Primer: A14346_R TCCTGCCCCACCCTGAC
Reviews

Customers who bought this product also purchased
A14348
A14348
A14347
A14347
A14345
A14345
A14344
A14344
A14343
A14343
A14349
A14349
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies