Top » Catalog » R1a » A14346

$18.00

A14346
[A14346]

A14346
hg38 Position: ChrY:11952057..11952057
Ancestral: C
Derived: T
Reference: Yfull (2017)
ISOGG Haplogroup: R1a (not listed)
Comments: Below L260 > Y2905 > YP1364 > YP3927 > YP4772
Forward Primer: A14346_F AGGAAGGTGTGAAGGATAGGC
Reverse Primer: A14346_R TCCTGCCCCACCCTGAC
Reviews

Customers who bought this product also purchased
A14344
A14344
A14343
A14343
A14349
A14349
R1a-YP4772 Sporzynski Family Panel
R1a-YP4772 Sporzynski Family Panel
A14348
A14348
A14347
A14347
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies