Top » Catalog » R1a » A14495

$18.00

A14495
[A14495]

A14495
hg38 Position: ChrY:9810973..9810973
Ancestral: T
Derived: A
Reference: Michael Cooley (2017)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream of YP448 > YP355 > YP609 > YP4248 > YP4491
Forward Primer: A14495_F TGTTCTCACACCTCGGACTG
Reverse Primer: A14495_R CTCCTTCAGTGGGTTGTTGC
Reviews

Customers who bought this product also purchased
A14496
A14496
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies