Top » Catalog » R1a » A14496

$18.00

A14496
[A14496]

A14496
hg38 Position: ChrY:12677863..12677863
Ancestral: T
Derived: G
Reference: Michael Cooley (2017)
ISOGG Haplogroup: R1a (not listed)
Comments: Downstream of YP448 > YP355 > YP609 > YP4248 > YP4491
Forward Primer: A14496vl_F TGCCCAAGATGATCAGGG
Reverse Primer: A14496vl_R CAGGACCCTTCTCTTTGCTG
Reviews

Customers who bought this product also purchased
A14495
A14495
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies