Top » Catalog » R1a » A14776

$18.00

A14776
[A14776]

A14776
hg38 Position: ChrY:10064886..10064886
Ancestral: C
Derived: T
Reference: Sergey Leonov (2017)
ISOGG Haplogroup: R1a (not listed)
Comments: Below Y18348
Forward Primer: A14776_F TGAGGAAGAAGCCCAGTCAG
Reverse Primer: A14776_R AGTGGGGCAGTAGATTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS636
1 x DYR112
1 x DYR76
1 x DYS389I+II
1 x DYS534
1 x DYS537
1 x DYS494
1 x DYS638
$84.65
Haplogroup Info
Other products
Currencies