Top » Catalog » R1a » FGC10360

$18.00

FGC10360
[FGC10360]

FGC10360
hg38 Position: ChrY:19844922..19844922
Ancestral: A
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below Y2902, above Y3219. Aka Y3226
Forward Primer: FGC10360_F AGCTGAGGGGGCTGTTATTC
Reverse Primer: FGC10360_R CATTGTTGGCCATGGTGAG
Reviews

Customers who bought this product also purchased
BY3502
BY3502
M458
M458
R1a Superclade Panel
R1a Superclade Panel
Y3220
Y3220
L1280
L1280
BY3301
BY3301
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies