Top » Catalog » R1a » L579

$18.00

L579
[L579]

L579
hg38 Position: ChrY:12915542..12915542
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1a1a1~
Comments: Found in a hg R-M417 WTY participant
Forward Primer: L579_F TCAACATGGGTAATTCGGTTG
Reverse Primer: L579_R GTTCTGAATGAAAGTTCAAACGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies