Top » Catalog » R1a » SUR2

$18.00

SUR2
[SUR2]

SUR2
hg38 Position: ChrY:15413358..15413358
Ancestral: C
Derived: A
Reference: Bulat Muratov (2014)
ISOGG Haplogroup: R1a1a1b2a2a~
Comments: Approx. Z2123
Forward Primer: SUR2v2_F CCTGCATGGAGATATATGTCTGTATC
Reverse Primer: SUR2v2_R TTTACTATTGCCAAGGAGTTTAACG
Reviews

Customers who bought this product also purchased
SUR81
SUR81
SUR54
SUR54
SUR92
SUR92
SUR59
SUR59
SUR65
SUR65
SUR246
SUR246
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies