Top » Catalog » R1a » CTS1806

$18.00

CTS1806
[CTS1806]

CTS1806
hg38 Position: ChrY:11956947..11956947
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a (not listed)
Comments: Observed in R1a-Z2123 and J1a-ZS1948
Forward Primer: CTS1806_F ATGGACAGGCGTGTGTTTG
Reverse Primer: CTS1806_R GAGGTAGAACAACGAAGAGATGC
Reviews

Customers who bought this product also purchased
FGC11
FGC11
FGC2
FGC2
FGC5
FGC5
FGC4415
FGC4415
ZS10710
ZS10710
FGC12
FGC12
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A8996
1 x FGC10636
1 x SUR12
$54.00
Haplogroup Info
Other products
Currencies