Top » Catalog » R1a » CTS1806

$18.00

CTS1806
[CTS1806]

CTS1806
hg38 Position: ChrY:11956947..11956947
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a (not listed)
Comments: Observed in R1a-Z2123 and J1a-ZS1948
Forward Primer: CTS1806_F ATGGACAGGCGTGTGTTTG
Reverse Primer: CTS1806_R GAGGTAGAACAACGAAGAGATGC
Reviews

Customers who bought this product also purchased
ZS11995
ZS11995
BY16791
BY16791
ZS4946
ZS4946
M267
M267
FGC1721
FGC1721
FGC1696
FGC1696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies