Top » Catalog » R1a » JN78

$18.00

JN78
[JN78]

JN78
hg38 Position: ChrY:12877601..12877601
Ancestral: A
Derived: T
Reference: Jakob Norstedt-Moberg (2017)
ISOGG Haplogroup: R1a
Comments: Below YP977
Forward Primer: JN78_F AAACTGGTGCAGGTGCTATG
Reverse Primer: JN78_R GTCCTTGGCATTCTGTCTCC
Reviews

Customers who bought this product also purchased
JN84
JN84
JN83
JN83
JN80
JN80
JN94
JN94
JN93
JN93
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC18221
$18.00
Haplogroup Info
Other products
Currencies