Top » Catalog » R1a » JN88

$18.00

JN88
[JN88]

JN88
hg38 Position: ChrY:12325174..12325174
Ancestral: G
Derived: C
Reference: Jakob Norstedt-Moberg (2017)
ISOGG Haplogroup: R1a
Comments: Below YP977
Forward Primer: JN88_F GCTAGACACGGAGCACTGAC
Reverse Primer: JN88_R CATCTGCCAATGGAATTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK2015
1 x JN85
1 x FGC32030
$54.00
Haplogroup Info
Other products
Currencies