Top » Catalog » R1a » JN91

$18.00

JN91
[JN91]

JN91
hg38 Position: ChrY:19247396..19247396
Ancestral: A
Derived: G
Reference: J. Norstedt (2017)
ISOGG Haplogroup: R1a (not listed)
Comments: Below YP977
Forward Primer: JN91_F CAGAGAGAAAGGTCAGGTTATTCAG
Reverse Primer: JN91_R AGACTATATTTTTCTTTGTCCATGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies