Top » Catalog » R1a » JN94

$18.00

JN94
[JN94]

JN94
hg38 Position: ChrY:20662988..20662988
Ancestral: A
Derived: C
Reference: J. Norstedt (2017)
ISOGG Haplogroup: R1a (not listed)
Comments: Below YP977
Forward Primer: JN94v2_F CACTCCACCCTTAAAAATATGCTG
Reverse Primer: JN94v2_R GTCTGGGGCCTGTGTCAC
Reviews

Customers who bought this product also purchased
JN78
JN78
JN93
JN93
JN84
JN84
JN83
JN83
JN80
JN80
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies