Top » Catalog » R1a » M12418

$18.00

M12418
[M12418]

M12418
hg38 Position: ChrY:15206734..15206734
Ancestral: T
Derived: C
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1a1a1b1a1b1
Comments: Aka YP4848
Forward Primer: M12418_F GCAACGAAGTCACCCATTACAC
Reverse Primer: M12418_R GCAAGGTTGACAATGAGGC
Reviews

Customers who bought this product also purchased
YP728
YP728
YP263
YP263
YP417
YP417
YP418
YP418
YP619
YP619
YP1013
YP1013
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19345
1 x BY25075
1 x Y46378
$54.00
Haplogroup Info
Other products
Currencies