Top » Catalog » R1a » CLD71

$18.00

CLD71
[CLD71]

CLD71
hg38 Position: ChrY:10038876..10038876
Ancestral: C
Derived: G
Reference: Doug McDonald (2016)
ISOGG Haplogroup: R1a
Comments: Downstream YP327 > FGC11892 > CLD33
Forward Primer: CLD71_F GATAGCTGTCTCATCATCCCTTC
Reverse Primer: CLD71_R CCTCCCTGGGCACAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY5800
1 x FGC17491
1 x A10050
$54.00
Haplogroup Info
Other products
Currencies