Top » Catalog » R1a » CLD73

$18.00

CLD73
[CLD73]

CLD73
hg38 Position: ChrY:7748861..7748861
Ancestral: T
Derived: C
Reference: Doug McDonald (2016)
ISOGG Haplogroup: R1a
Comments: Downstream YP327 > FGC11892 > CLD33
Forward Primer: CLD73_F ACCCAATCACTTCGCTGTTC
Reverse Primer: CLD73_R AACCCTCAAGGTGGTGTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC36044
1 x A6248
1 x BY4620
1 x Y15173
$72.00
Haplogroup Info
Other products
Currencies