Top » Catalog » R1a » CLD74

$18.00

CLD74
[CLD74]

CLD74
hg38 Position: ChrY:12218019..12218019
Ancestral: T
Derived: C
Reference: Doug McDonald (2016)
ISOGG Haplogroup: R1a
Comments: Downstream YP327 > FGC11892 > CLD33
Forward Primer: CLD74_F CAGGGCACACTTTTTCTTCC
Reverse Primer: CLD74_R GGTGAAAAAGGAAGTGCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies