Top » Catalog » R1a » S5730

$18.00

S5730
[S5730]

S5730
hg38 Position: ChrY:21366167..21366167
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a1a1b1a3b2 (not listed)
Comments: Below CTS8746.
Forward Primer: S5730_F CAACTGGAACTTAAACGGTAGCTC
Reverse Primer: S5730_R AACTGTACTATAACCTTTCAAGTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies