Top » Catalog » R1a » A19100

$18.00

A19100
[A19100]

A19100
hg38 Position: ChrY:12061672..12061672
Ancestral: C
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19100_F TAAATCATCAGTAAACTCCCATTTC
Reverse Primer: A19100_R TCTTTTGATTCAGCTTCATTTTTCTAC
Reviews

Customers who bought this product also purchased
A19113
A19113
FGC21103
FGC21103
A19077
A19077
A19152
A19152
FGC21108
FGC21108
A19088
A19088
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY5800
1 x FGC17491
1 x A10050
1 x A24035
$72.00
Haplogroup Info
Other products
Currencies