Top » Catalog » R1a » A19105

$18.00

A19105
[A19105]

A19105
hg38 Position: ChrY:12559671..12559671
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19105v2_F GAATTTCACAAGATAATGTCATCAGTTAG
Reverse Primer: A19105v2_R CGGAACTTGTGTCTTCTGTTTG
Reviews

Customers who bought this product also purchased
A19088
A19088
A19314
A19314
FGC21114
FGC21114
A19112
A19112
FGC21102
FGC21102
R1a-YP942 Voldan Panel
R1a-YP942 Voldan Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies