Top » Catalog » R1a » A19117

$18.00

A19117
[A19117]

A19117
hg38 Position: ChrY:14133469..14133469
Ancestral: A
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19117_F TTGCCCCAGACACTTTTAGC
Reverse Primer: A19117_R TCAATTGCAAGAGGCTTTCC
Reviews

Customers who bought this product also purchased
R1a-YP6375 Bures Panel
R1a-YP6375 Bures Panel
FGC21229
FGC21229
A19123
A19123
FGC21241
FGC21241
FGC21219
FGC21219
FGC21227
FGC21227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies