Top » Catalog » R1a » A19117

$18.00

A19117
[A19117]

A19117
hg38 Position: ChrY:14133469..14133469
Ancestral: A
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP6376
Forward Primer: A19117_F TTGCCCCAGACACTTTTAGC
Reverse Primer: A19117_R TCAATTGCAAGAGGCTTTCC
Reviews

Customers who bought this product also purchased
FGC21223
FGC21223
A19083
A19083
FGC21234
FGC21234
A19137
A19137
FGC21244
FGC21244
FGC21220
FGC21220
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies