Top » Catalog » R1a » A19119

$18.00

A19119
[A19119]

A19119
hg38 Position: ChrY:14427924..14427924
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19119_F TGGTGACGTTCCTTCTCCTC
Reverse Primer: A19119_R TGTCTCTCCCTCCACACCTC
Reviews

Customers who bought this product also purchased
A19107
A19107
FGC21102
FGC21102
R1a-YP942 Voldan Panel
R1a-YP942 Voldan Panel
A19142
A19142
FGC21107
FGC21107
A19086
A19086
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies