Top » Catalog » R1a » A19153

$18.00

A19153
[A19153]

A19153
hg38 Position: ChrY:20920334..20920334
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19153_F GCAAAACCTGCCTCCCAG
Reverse Primer: A19153_R TTGTGGAAGTCAGTGTAGCGAC
Reviews

Customers who bought this product also purchased
A19105
A19105
CTS4994
CTS4994
A19126
A19126
FGC21106
FGC21106
A19084
A19084
A19156
A19156
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH2350
1 x A22591
1 x A15508
1 x Y19107
$72.00
Haplogroup Info
Other products
Currencies