Top » Catalog » R1a » A19153

$18.00

A19153
[A19153]

A19153
hg38 Position: ChrY:20920334..20920334
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: YP942
Forward Primer: A19153_F GCAAAACCTGCCTCCCAG
Reverse Primer: A19153_R TTGTGGAAGTCAGTGTAGCGAC
Reviews

Customers who bought this product also purchased
R1a-YP942 Voldan Panel
R1a-YP942 Voldan Panel
A19127
A19127
FGC21107
FGC21107
A19086
A19086
A19159
A19159
FGC21113
FGC21113
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies