Top » Catalog » R1a » A19332

$18.00

A19332
[A19332]

A19332
hg38 Position: ChrY:14372900..14372900
Ancestral: G
Derived: A
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19332_F TGGCAGCTGGTCAGATTTAG
Reverse Primer: A19332_R GCTGATCCATCATTCATTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies