Top » Catalog » R1a » A19354

$18.00

A19354
[A19354]

A19354
hg38 Position: ChrY:17198051..17198051
Ancestral: T
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19354_F CCATGTGTCCAGAAGTGGTG
Reverse Primer: A19354_R AGGGGAGGGACAACATTAGG
Reviews

Customers who bought this product also purchased
A19351
A19351
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
A19357
A19357
A19345
A19345
CTS10301
CTS10301
A19350
A19350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY3572
$18.00
Haplogroup Info
Other products
Currencies