Top » Catalog » R1a » M12429

$18.00

M12429
[M12429]

M12429
hg38 Position: ChrY:6846819..6846819
Ancestral: C
Derived: T
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Found in P0 Genomic Blood. Aka Y6663
Forward Primer: M12429_F TTCCTGGCAGCTTCCTTAAC
Reverse Primer: M12429_R CCTAGCCAAGAGAAGCCTTG
Reviews

Customers who bought this product also purchased
A19351
A19351
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
A19356
A19356
A19345
A19345
A19934
A19934
A19350
A19350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies