Top » Catalog » R1a » M12429

$18.00

M12429
[M12429]

M12429
hg38 Position: ChrY:6846819..6846819
Ancestral: C
Derived: T
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Found in P0 Genomic Blood. Aka Y6663
Forward Primer: M12429_F TTCCTGGCAGCTTCCTTAAC
Reverse Primer: M12429_R CCTAGCCAAGAGAAGCCTTG
Reviews

Customers who bought this product also purchased
A19344
A19344
A19933
A19933
A19349
A19349
M12462
M12462
A19354
A19354
A19343
A19343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies