Top » Catalog » R1a » M12429

$18.00

M12429
[M12429]

M12429
hg38 Position: ChrY:6846819..6846819
Ancestral: C
Derived: T
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Found in P0 Genomic Blood. Aka Y6663
Forward Primer: M12429_F TTCCTGGCAGCTTCCTTAAC
Reverse Primer: M12429_R CCTAGCCAAGAGAAGCCTTG
Reviews

Customers who bought this product also purchased
A19353
A19353
A19342
A19342
A19360
A19360
A19347
A19347
M12430
M12430
A19352
A19352
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies